Solanum lycopersicum
Marker Information
| Marker name | TES0690 | ||
|---|---|---|---|
| Marker category | EST-SSR | ||
| Primer sequences | Fw | GCCAAGATTTGGGAGAAGGAA | |
| Rv | TTGAGCTCCAAAACATACAAAGA | ||
| EST/Genome sequences | Singlet1811 | ||
| Lines | |||
| PIC | Value | ||
| Lines | |||
| Linkage Map | Expen2000 | Linkage | ch05 |
| Position | 3.509 | ||
| SNP | Position | ||
| Method | |||
| SSR | Fragment size | 190 | |
| Pattern* | AT(mis1) | ||
| Repeat count | 12 | ||
| Method | PCR | ||
| Detection | |||
| Multiplex | |||
| Gel image | |||
| Enzyme | |||
| Related markers | Marker name | ||
| Species | |||
| Comments | KDRI | ||
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.