Solanum lycopersicum
Marker Information
Marker name | TES0111 | ||
---|---|---|---|
Marker category | EST-SSR | ||
Primer sequences | Fw | ATCTCCTTGGCCTCCTGTTT | |
Rv | GTCATGGCCACATGAATACG | ||
EST/Genome sequences | Contig9855 | ||
Lines | |||
PIC | Value | ||
Lines | |||
Linkage Map | Expen2000 | Linkage | ch06 |
Position | 9.823 | ||
SNP | Position | ||
Method | |||
SSR | Fragment size | 199 | |
Pattern* | GGT | ||
Repeat count | 9 | ||
Method | PCR | ||
Detection | |||
Multiplex | |||
Gel image | |||
Enzyme | |||
Related markers | Marker name | ||
Species | |||
Comments | KDRI |
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.