Fragaria x ananassa
Marker Information
| Marker name | FVES1485 | ||
|---|---|---|---|
| Marker category | FVES | ||
| Primer sequences | Fw | CCAACTTCACCACCATTCCT | |
| Rv | TTGCCTTTTGTGTCTGGTCA | ||
| EST/Genome sequences | EX683876 | ||
| Lines | |||
| PIC | Value | ||
| Lines | 24 | ||
| Integrated Map | Locus | FVES1485 | |
| Linkage | 2B | ||
| Position | 44.8 | ||
| Physical Map | Chromosome | Fvb2 | |
| Position | 8557538 | ||
| SNP | Position | ||
| Method | |||
| SSR | Fragment size | 232 | |
| Pattern* | GGT | ||
| Repeat count | 6 | ||
| Method | PCR | TD | |
| Detection | 10% acrylamide | ||
| Multiplex | |||
| Gel image | |||
| Enzyme | |||
| Related markers | Marker name | ||
| Species | |||
| Comments | F. vesca EST-SSR | ||
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.