Fragaria x ananassa
Marker Information
Marker name | FVES1304 | ||
---|---|---|---|
Marker category | FVES | ||
Primer sequences | Fw | AACCAGGCCTTTGAGAAGGT | |
Rv | GTGAAAGCAGATTTCCGAGC | ||
EST/Genome sequences | EX672492 | ||
Lines | |||
PIC | Value | ||
Lines | 24 | ||
Physical Map | Chromosome | Fvb1 | |
Position | 13025755 | ||
SNP | Position | ||
Method | |||
SSR | Fragment size | 298 | |
Pattern* | ACG | ||
Repeat count | 7 | ||
Method | PCR | TD | |
Detection | 10% acrylamide | ||
Multiplex | |||
Gel image | |||
Enzyme | |||
Related markers | Marker name | ||
Species | |||
Comments | F. vesca EST-SSR |
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.