Fragaria x ananassa
        Marker Information
| Marker name | FVES0680 | ||
|---|---|---|---|
| Marker category | FVES | ||
| Primer sequences | Fw | AAGGATTGTTTGGAGAGAGAAA | |
| Rv | AGGACGATTTGAAGGTGGTG | ||
| EST/Genome sequences | DY673276 | ||
| Lines | |||
| PIC | Value | ||
| Lines | 24 | ||
| Physical Map | Chromosome | Fvb3 | |
| Position | 21896461 | ||
| SNP | Position | ||
| Method | |||
| SSR | Fragment size | 111 | |
| Pattern* | AG | ||
| Repeat count | 9 | ||
| Method | PCR | TD | |
| Detection | 10% acrylamide | ||
| Multiplex | |||
| Gel image | |||
| Enzyme | |||
| Related markers | Marker name | ||
| Species | |||
| Comments | F. vesca EST-SSR | ||
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.