
Marker Information
Marker name | FVES0104 | ||
---|---|---|---|
Marker category | FVES | ||
Primer sequences | Fw | CTGCCTTCTGGGTCGTTAAA | |
Rv | AAGACGTCGACGAGTCCCTA | ||
EST/Genome sequences | DY674624 | ||
Lines | |||
PIC | Value | ||
Lines | 24 | ||
Integrated Map | Locus | FVES0104_7a1 | |
Linkage | 7A | ||
Position | 53.300 | ||
Integrated Map | Locus | FVES0104_7b1 | |
Linkage | 7B | ||
Position | 40.100 | ||
Integrated Map | Locus | FVES0104_7b2 | |
Linkage | 7B | ||
Position | 50.900 | ||
Integrated Map | Locus | FVES0104_7b3 | |
Linkage | 7B | ||
Position | 51.500 | ||
Integrated Map | Locus | FVES0104_7d | |
Linkage | 7D | ||
Position | 55.000 | ||
Integrated Map | Locus | FVES0104_7x | |
Linkage | 7X (Akihime) | ||
Position | |||
Physical Map | Chromosome | Fvb7 | |
Position | 17926303 | ||
SNP | Position | ||
Method | |||
SSR | Fragment size | 244 | |
Pattern* | AAG | ||
Repeat count | 9 | ||
Method | PCR | TD | |
Detection | 10% acrylamide | ||
Multiplex | |||
Gel image | FVES0104.jpg | ||
Enzyme | |||
Related markers | Marker name | ||
Species | |||
Comments | F. vesca EST-SSR |
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.