Fragaria x ananassa
Marker Information
| Marker name | FATS0064 | ||
|---|---|---|---|
| Marker category | FATS | ||
| Primer sequences | Fw | AGAAGAGCAGAAGAGAGAGGAGT | |
| Rv | TCTTGCTGCTCACCTTTCG | ||
| EST/Genome sequences | Contig16905 | ||
| Lines | |||
| PIC | Value | ||
| Lines | |||
| Integrated Map | Locus | FATS0064 | |
| Linkage | 4D | ||
| Position | 21.200 | ||
| Physical Map | Chromosome | Fvb4 | |
| Position | 13655500 | ||
| SNP | Position | ||
| Method | |||
| SSR | Fragment size | 149 | |
| Pattern* | GGA | ||
| Repeat count | 6 | ||
| Method | PCR | ||
| Detection | |||
| Multiplex | |||
| Gel image | |||
| Enzyme | |||
| Related markers | Marker name | ||
| Species | |||
| Comments | F. x ananassa transcript-SSR | ||
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.