Fragaria x ananassa
Marker Information
| Marker name | FATS0057 | ||
|---|---|---|---|
| Marker category | FATS | ||
| Primer sequences | Fw | CTTGCATTGGAAAAGCTCGT | |
| Rv | TCTGCATGAAAATCAAAGAATCA | ||
| EST/Genome sequences | Contig16023 | ||
| Lines | |||
| PIC | Value | ||
| Lines | |||
| Integrated Map | Locus | FATS0057_5a | |
| Linkage | 5A | ||
| Position | 86.900 | ||
| Integrated Map | Locus | FATS0057_5d | |
| Linkage | 5D | ||
| Position | 46.000 | ||
| Integrated Map | Locus | FATS0057_6a | |
| Linkage | 6A | ||
| Position | 109.800 | ||
| SNP | Position | ||
| Method | |||
| SSR | Fragment size | 169 | |
| Pattern* | CTT | ||
| Repeat count | 8 | ||
| Method | PCR | ||
| Detection | |||
| Multiplex | |||
| Gel image | |||
| Enzyme | |||
| Related markers | Marker name | ||
| Species | |||
| Comments | F. x ananassa transcript-SSR | ||
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.