Fragaria x ananassa
Marker Information
Marker name | FATS0028 | ||
---|---|---|---|
Marker category | FATS | ||
Primer sequences | Fw | GCCCGGTCTCTCATTTTCAC | |
Rv | GTTGCCTATGGTTCCACCTC | ||
EST/Genome sequences | Contig8804 | ||
Lines | |||
PIC | Value | ||
Lines | |||
Physical Map | Chromosome | Fvb5 | |
Position | 11294981 | ||
SNP | Position | ||
Method | |||
SSR | Fragment size | 157 | |
Pattern* | CCCATA | ||
Repeat count | 2 | ||
Method | PCR | ||
Detection | |||
Multiplex | |||
Gel image | |||
Enzyme | |||
Related markers | Marker name | ||
Species | |||
Comments | F. x ananassa transcript-SSR |
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.