Fragaria x ananassa
Marker Information
Marker name | FAES0277 | ||
---|---|---|---|
Marker category | FAES | ||
Primer sequences | Fw | GAACTCCCTTTTCTGGGTCC | |
Rv | CAATGAGTGGGAGAGGAAGG | ||
EST/Genome sequences | CO817234 | ||
Lines | |||
PIC | Value | ||
Lines | 24 | ||
Integrated Map | Locus | FAES0277 | |
Linkage | 2D | ||
Position | 59.600 | ||
SNP | Position | ||
Method | |||
SSR | Fragment size | 243 | |
Pattern* | AT | ||
Repeat count | 9 | ||
Method | PCR | TD | |
Detection | 10% acrylamide | ||
Multiplex | |||
Gel image | FAES0277.jpg | ||
Enzyme | |||
Related markers | Marker name | ||
Species | |||
Comments | F. x ananassa EST-SSR |
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.