Fragaria x ananassa
Marker Information
| Marker name | FAES0151 | ||
|---|---|---|---|
| Marker category | FAES | ||
| Primer sequences | Fw | GCCTCCAAAGGTTGTTACTTCTT | |
| Rv | ACTTTGCTCGAGCCATCAAT | ||
| EST/Genome sequences | CO381600 | ||
| Lines | |||
| PIC | Value | ||
| Lines | 24 | ||
| Integrated Map | Locus | FAES0151_3a | |
| Linkage | 3A | ||
| Position | 65.700 | ||
| Integrated Map | Locus | FAES0151_3b1 | |
| Linkage | 3B | ||
| Position | 59.400 | ||
| Integrated Map | Locus | FAES0151_3b2 | |
| Linkage | 3B | ||
| Position | 74.000 | ||
| Integrated Map | Locus | FAES0151_3c | |
| Linkage | 3C | ||
| Position | 24.100 | ||
| Physical Map | Chromosome | Fvb3 | |
| Position | 27919158 | ||
| SNP | Position | ||
| Method | |||
| SSR | Fragment size | 284 | |
| Pattern* | AATG | ||
| Repeat count | 4 | ||
| Method | PCR | TD | |
| Detection | 10% acrylamide | ||
| Multiplex | |||
| Gel image | FAES0151.jpg | ||
| Enzyme | |||
| Related markers | Marker name | ||
| Species | |||
| Comments | F. x ananassa EST-SSR | ||
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.