Fragaria x ananassa
Marker Information
| Marker name | EMFn170 | ||
|---|---|---|---|
| Marker category | Other-SSR | ||
| Primer sequences | Fw | CAGTTTGCCCAACAACAAGG | |
| Rv | TTGATGGCAACAAATCACG | ||
| EST/Genome sequences | AM051339 | ||
| Lines | |||
| PIC | Value | ||
| Lines | |||
| Integrated Map | Locus | EMFn170 | |
| Linkage | 3A | ||
| Position | 54.100 | ||
| Physical Map | Chromosome | Fvb3 | |
| Position | 11489970 | ||
| SNP | Position | ||
| Method | |||
| SSR | Fragment size | ||
| Pattern* | |||
| Repeat count | |||
| Method | PCR | ||
| Detection | |||
| Multiplex | |||
| Gel image | |||
| Enzyme | |||
| Related markers | Marker name | ||
| Species | |||
| Comments | F. nubicola Genome-SSR Sargent et al. (2006) |
||
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.