Fragaria x ananassa
Marker Information
| Marker name | CO817185 | ||
|---|---|---|---|
| Marker category | Other-SSR | ||
| Primer sequences | Fw | CGCTAGCTTTTCTGCTCGAT | |
| Rv | ACACTCCACCGGCTTACATC | ||
| EST/Genome sequences | |||
| Lines | |||
| PIC | Value | ||
| Lines | |||
| Physical Map | Chromosome | Fvb2 | |
| Position | 9105310 | ||
| SNP | Position | ||
| Method | |||
| SSR | Fragment size | ||
| Pattern* | |||
| Repeat count | |||
| Method | PCR | ||
| Detection | |||
| Multiplex | |||
| Gel image | |||
| Enzyme | |||
| Related markers | Marker name | ||
| Species | |||
| Comments | F. x ananassa EST-SSR Spigler et al. (2008) |
||
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.