Glycine max
Marker Information
| Marker name | GMES1923 | ||
|---|---|---|---|
| Marker category | EST-SSR | ||
| Primer sequences | Fw | CTGTCTCCTCCGACTCCAAG | |
| Rv | TTTTCCTCTTGTCACCGTCC | ||
| EST/Genome sequences | TC217019 | ||
| Lines | |||
| PIC | Value | ||
| Lines | 24 | ||
| Physical Map | Chromosome | Gm17 | |
| Position | 3240983 | ||
| SNP | Position | ||
| Method | |||
| SSR | Fragment size | 171 | |
| Pattern* | GGA | ||
| Repeat count | 21 | ||
| Method | PCR | ||
| Detection | acrylamide | ||
| Multiplex | |||
| Gel image | |||
| Enzyme | |||
| Related markers | Marker name | ||
| Species | Lotus japonicus | ||
| Comments | |||
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.