Trifolium pratense
Marker Information
| Marker name | WCS1588 | ||
|---|---|---|---|
| Marker category | White_clover_EST-SSR | ||
| Primer sequences | Fw | TGGACAACAAGTTTCTTCCG | |
| Rv | CCTCGAAAACCAAGATCAGC | ||
| EST/Genome sequences | WCC18N07 (Other Page) | ||
| Lines | |||
| PIC | Value | ||
| Lines | |||
| Linkage Map | HR x R130 | Linkage | LG2 |
| Position | 7.402 | ||
| SNP | Position | ||
| Method | |||
| SSR | Fragment size | 300 | |
| Pattern* | AAC | ||
| Repeat count | 5 | ||
| Method | PCR | TD | |
| Detection | 10% acrylamide | ||
| Multiplex | |||
| Gel image | WCS1588 (Other Page) | ||
| Enzyme | |||
| Related markers | Marker name | ||
| Species | |||
| Comments | |||
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.