Trifolium pratense
Marker Information
Marker name | WCS1550 | ||
---|---|---|---|
Marker category | White_clover_EST-SSR | ||
Primer sequences | Fw | AGCTTCTGCAATTGACGCTT | |
Rv | AGGAGGATTAGCAACAGCGA | ||
EST/Genome sequences | WCC19A03 | ||
Lines | |||
PIC | Value | ||
Lines | |||
Linkage Map | HR x R130 | Linkage | LG2 |
Position | 74.159 | ||
SNP | Position | ||
Method | |||
SSR | Fragment size | 148 | |
Pattern* | AAT | ||
Repeat count | 5 | ||
Method | PCR | TD | |
Detection | 10% acrylamide | ||
Multiplex | |||
Gel image | http://marker.kazusa.or.jp/White_clover/marker/image/WCS1550 | ||
Enzyme | |||
Related markers | Marker name | ||
Species | |||
Comments |
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.