Trifolium pratense
Marker Information
Marker name | RCS6830 | ||
---|---|---|---|
Marker category | Red_clover_SSR | ||
Primer sequences | Fw | CAACAGCATAAACCGAAGCA | |
Rv | CCAGCTTGATCCACACATTG | ||
EST/Genome sequences | BB923405 | ||
Lines | |||
PIC | Value | ||
Lines | |||
Linkage Map | HR x R130 | Linkage | LG6 |
Position | 33.101 | ||
SNP | Position | ||
Method | |||
SSR | Fragment size | 263 | |
Pattern* | AAGC | ||
Repeat count | 16 | ||
Method | PCR | TD | |
Detection | 10% acrylamide | ||
Multiplex | |||
Gel image | http://clovergarden.jp/Red/cgi-bin/photo.cgi?name=RCS6830 | ||
Enzyme | |||
Related markers | Marker name | mth2-14n9 | |
Species | Medicago truncatula | ||
Comments |
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.