Trifolium pratense
Marker Information
| Marker name | RCS5969 | ||
|---|---|---|---|
| Marker category | Red_clover_SSR | ||
| Primer sequences | Fw | TGCCAAATGTAATCAATGCAA | |
| Rv | CGGTCATCCCACTTATCCAC | ||
| EST/Genome sequences | BB915030 | ||
| Lines | |||
| PIC | Value | ||
| Lines | |||
| Linkage Map | HR x R130 | Linkage | LG7 |
| Position | 62.77 | ||
| SNP | Position | ||
| Method | |||
| SSR | Fragment size | 166 | |
| Pattern* | AAG | ||
| Repeat count | 18 | ||
| Method | PCR | TD | |
| Detection | 10% acrylamide | ||
| Multiplex | |||
| Gel image | |||
| Enzyme | |||
| Related markers | Marker name | AP010044, mth2-19g23 | |
| Species | Lotus japonicus, Medicago truncatula | ||
| Comments | |||
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.