Trifolium pratense
Marker Information
| Marker name | RCS5208 | ||
|---|---|---|---|
| Marker category | Red_clover_SSR | ||
| Primer sequences | Fw | TCCATCGTTTAAATCTCACGC | |
| Rv | ACGCGCTTTTTCAAAACACT | ||
| EST/Genome sequences | BB912394 | ||
| Lines | |||
| PIC | Value | 0.79 | |
| Lines | 48 | ||
| Linkage Map | HR x R130 | Linkage | LG2 |
| Position | 17.225 | ||
| SNP | Position | ||
| Method | |||
| SSR | Fragment size | 190 | |
| Pattern* | AG | ||
| Repeat count | 27 | ||
| Method | PCR | TD | |
| Detection | 10% acrylamide | ||
| Multiplex | |||
| Gel image | http://clovergarden.jp/Red/cgi-bin/photo.cgi?name=RCS5208 | ||
| Enzyme | |||
| Related markers | Marker name | AP007419, mth2-66m17 | |
| Species | Lotus japonicus, Medicago truncatula | ||
| Comments | |||
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.