Trifolium pratense
Marker Information
| Marker name | RCS1327 | ||
|---|---|---|---|
| Marker category | Red_clover_SSR | ||
| Primer sequences | Fw | ACGGTGGAATTATGGGATGA | |
| Rv | AAACAAACCAAGCAGCACCT | ||
| EST/Genome sequences | BB929119 | ||
| Lines | |||
| PIC | Value | ||
| Lines | |||
| Linkage Map | HR x R130 | Linkage | LG6 |
| Position | 28.799 | ||
| SNP | Position | ||
| Method | |||
| SSR | Fragment size | 244 | |
| Pattern* | ATC | ||
| Repeat count | 24 | ||
| Method | PCR | TD | |
| Detection | 10% acrylamide | ||
| Multiplex | |||
| Gel image | http://clovergarden.jp/Red/cgi-bin/photo.cgi?name=RCS1327 | ||
| Enzyme | |||
| Related markers | Marker name | mth2-70d8 | |
| Species | Medicago truncatula | ||
| Comments | |||
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.