Trifolium pratense
Marker Information
| Marker name | RCS1113 | ||
|---|---|---|---|
| Marker category | Red_clover_SSR | ||
| Primer sequences | Fw | CATCCTCCAAAACCCTCCTT | |
| Rv | TCATCATCATCACCGGAAAG | ||
| EST/Genome sequences | DE217912 | ||
| Lines | |||
| PIC | Value | 0.81 | |
| Lines | 48 | ||
| Linkage Map | HR x R130 | Linkage | LG2 |
| Position | 34.098 | ||
| SNP | Position | ||
| Method | |||
| SSR | Fragment size | 158 | |
| Pattern* | GGT | ||
| Repeat count | 21 | ||
| Method | PCR | TD | |
| Detection | 10% acrylamide | ||
| Multiplex | |||
| Gel image | |||
| Enzyme | |||
| Related markers | Marker name | AP009675 | |
| Species | Lotus japonicus | ||
| Comments | |||
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.