Trifolium pratense
Marker Information
| Marker name | RCS0998 | ||
|---|---|---|---|
| Marker category | Red_clover_SSR | ||
| Primer sequences | Fw | TGAGGAAAATGAGACCAGTGA | |
| Rv | TTCTTGCCACAACTTTTCCA | ||
| EST/Genome sequences | DE217366 | ||
| Lines | |||
| PIC | Value | 0.69 | |
| Lines | 48 | ||
| Linkage Map | HR x R130 | Linkage | LG6 |
| Position | 79.228 | ||
| SNP | Position | ||
| Method | |||
| SSR | Fragment size | 157 | |
| Pattern* | ATC | ||
| Repeat count | 19 | ||
| Method | PCR | TD | |
| Detection | 10% acrylamide | ||
| Multiplex | |||
| Gel image | |||
| Enzyme | |||
| Related markers | Marker name | ||
| Species | |||
| Comments | |||
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.