Trifolium pratense
Marker Information
| Marker name | RCS0015 | ||
|---|---|---|---|
| Marker category | Red_clover_SSR | ||
| Primer sequences | Fw | CGTGATTCCACCCCTAAAAA | |
| Rv | GCGCACAATGAAAGCTCA | ||
| EST/Genome sequences | DE246169 | ||
| Lines | |||
| PIC | Value | ||
| Lines | |||
| SNP | Position | ||
| Method | |||
| SSR | Fragment size | 157 | |
| Pattern* | AT | ||
| Repeat count | 37 | ||
| Method | PCR | TD | |
| Detection | 10% acrylamide | ||
| Multiplex | |||
| Gel image | |||
| Enzyme | |||
| Related markers | Marker name | ||
| Species | |||
| Comments | |||
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.