Capsicum annuum
Marker Information
| Marker name | matK | ||
|---|---|---|---|
| Marker category | SNP | ||
| Primer sequences | Fw | CGTACAGTACTTTTGTGTTTACGAG | |
| Rv | ACCCAGTCCATCTGGAAATCTTGGTTC | ||
| EST/Genome sequences | matK | ||
| Lines | 192 | ||
| PIC | Value | ||
| Lines | |||
| SNP | Position | 526 | |
| Method | Sequencing | ||
| SSR | Fragment size | 553 | |
| Pattern* | |||
| Repeat count | |||
| Method | PCR | 55 | |
| Detection | |||
| Multiplex | |||
| Gel image | |||
| Enzyme | |||
| Related markers | Marker name | ||
| Species | |||
| Comments | CBOL Plant Working Group (2009) | ||
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.