
Marker Information
Marker name | CaES5301 | ||
---|---|---|---|
Marker category | EST-SSR | ||
Primer sequences | Fw | TGTAAAATCCGGGTGGAAGA | |
Rv | TTTTCCATGGTTTCAAAGGC | ||
EST/Genome sequences | CO908339 (Other Page) | ||
Lines | 192 | ||
PIC | Value | 0.43 | |
Lines | 188 | ||
SNP | Position | ||
Method | |||
SSR | Fragment size | 99 | |
Pattern* | AGC(mis2) | ||
Repeat count | 5 | ||
Method | PCR | MAP-TD | |
Detection | 3730 | ||
Multiplex | |||
Gel image | |||
Enzyme | |||
Related markers | Marker name | ||
Species | |||
Comments |
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.