Capsicum annuum
Marker Information
| Marker name | CaES3853 | ||
|---|---|---|---|
| Marker category | EST-SSR | ||
| Primer sequences | Fw | ATGAGGCCAAAATCAAGGTG | |
| Rv | CACCAAGTCCCCTTGTGAGT | ||
| EST/Genome sequences | GD078643 (Other Page) | ||
| Lines | |||
| PIC | Value | ||
| Lines | |||
| SNP | Position | ||
| Method | |||
| SSR | Fragment size | 189 | |
| Pattern* | GGT(mis2) | ||
| Repeat count | 5 | ||
| Method | PCR | ||
| Detection | |||
| Multiplex | |||
| Gel image | |||
| Enzyme | |||
| Related markers | Marker name | ||
| Species | |||
| Comments | |||
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.