Capsicum annuum
Marker Information
| Marker name | CaES1027 | ||
|---|---|---|---|
| Marker category | EST-SSR | ||
| Primer sequences | Fw | ACGAGACGAGGGTCTCAAAA | |
| Rv | CCAAGAACTCATCGGTAGCC | ||
| EST/Genome sequences | GO344527 (Other Page) | ||
| Lines | 192 | ||
| PIC | Value | 0.02 | |
| Lines | 192 | ||
| SNP | Position | ||
| Method | |||
| SSR | Fragment size | 93 | |
| Pattern* | AAG(mis1) | ||
| Repeat count | 5 | ||
| Method | PCR | MAP-TD | |
| Detection | 3730 | ||
| Multiplex | |||
| Gel image | |||
| Enzyme | |||
| Related markers | Marker name | ||
| Species | |||
| Comments | |||
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.