Arachis hypogaea
Marker Information
| Marker name | TC9B08 | ||
|---|---|---|---|
| Marker category | Publicly available markers | ||
| Primer sequences | Fw | GGTTGGGTTGAGAACAAGG | |
| Rv | ACCCTCACCACTAACTCCATTA | ||
| EST/Genome sequences | DQ099147 | ||
| Lines | |||
| PIC | Value | ||
| Lines | |||
| Linkage Map | SKF2 | Linkage | LG08.1 |
| Position | 37.558 | ||
| TF6 | Linkage | TA08 | |
| Position | 10.339 | ||
| Integrated consensus map | Linkage | A08 | |
| Position | 13.818 | ||
| SNP | Position | ||
| Method | |||
| SSR | Fragment size | ||
| Pattern* | |||
| Repeat count | |||
| Method | PCR | ||
| Detection | |||
| Multiplex | |||
| Gel image | |||
| Enzyme | |||
| Related markers | Marker name | ||
| Species | |||
| Comments | Moretzsohn et al. (2005) ABS0354 |
||
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.