Arachis hypogaea
Marker Information
| Marker name | TC6H03 | ||
|---|---|---|---|
| Marker category | Publicly available markers | ||
| Primer sequences | Fw | TCACAATCAGAGCTCCAACAA | |
| Rv | CAGGTTCACCAGGAACGAGT | ||
| EST/Genome sequences | DQ099227 (Other Page) | ||
| Lines | |||
| PIC | Value | ||
| Lines | |||
| Linkage Map | SKF2 | Linkage | LG08.1 |
| Position | 132.253 | ||
| SKF2 | Linkage | LG08.2 | |
| Position | 52.391 | ||
| AF5 | Linkage | AA08 | |
| Position | 64.468 | ||
| BF6 | Linkage | BB08 | |
| Position | 17.862 | ||
| TF6 | Linkage | TA08 | |
| Position | 61.128 | ||
| TF6 | Linkage | TB08 | |
| Position | 17.22 | ||
| Integrated consensus map | Linkage | A08 | |
| Position | 76.338 | ||
| Integrated consensus map | Linkage | B08 | |
| Position | 54.56 | ||
| SNP | Position | ||
| Method | |||
| SSR | Fragment size | ||
| Pattern* | |||
| Repeat count | |||
| Method | PCR | ||
| Detection | |||
| Multiplex | |||
| Gel image | |||
| Enzyme | |||
| Related markers | Marker name | ||
| Species | |||
| Comments | Moretzsohn et al. (2005) ABS0343 |
||
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.