Arachis hypogaea
Marker Information
| Marker name | TC11A04 | ||
|---|---|---|---|
| Marker category | Publicly available markers | ||
| Primer sequences | Fw | ACTCTGCATGGATGGCTACAG | |
| Rv | CATGTTCGGTTTCAAGTCTCAA | ||
| EST/Genome sequences | DQ099236 (Other Page) | ||
| Lines | |||
| PIC | Value | ||
| Lines | |||
| Linkage Map | SKF2 | Linkage | LG06.1 |
| Position | 27.809 | ||
| SKF2 | Linkage | LG06.2 | |
| Position | 60.319 | ||
| AF5 | Linkage | AA06 | |
| Position | 36.977 | ||
| BF6 | Linkage | BB06 | |
| Position | 26.458 | ||
| TF6 | Linkage | TA06 | |
| Position | 64.144 | ||
| Integrated consensus map | Linkage | A06 | |
| Position | 62.721 | ||
| Integrated consensus map | Linkage | A10 | |
| Position | 84.112 | ||
| Integrated consensus map | Linkage | B06 | |
| Position | 91.458 | ||
| SNP | Position | ||
| Method | |||
| SSR | Fragment size | ||
| Pattern* | |||
| Repeat count | |||
| Method | PCR | ||
| Detection | |||
| Multiplex | |||
| Gel image | |||
| Enzyme | |||
| Related markers | Marker name | ||
| Species | |||
| Comments | Moretzsohn et al. (2005) ABS0365 |
||
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.