Arachis hypogaea
Marker Information
Marker name | PM238 | ||
---|---|---|---|
Marker category | Publicly available markers | ||
Primer sequences | Fw | CTCTCCTCTGCTCTGCACTG | |
Rv | ACAAGAACATGGGGATGAAGA | ||
EST/Genome sequences | AY237791 | ||
Lines | |||
PIC | Value | ||
Lines | |||
Linkage Map | SKF2 | Linkage | LG03.1 |
Position | 80.830 | ||
BF6 | Linkage | BB03 | |
Position | 12.602 | ||
TF6 | Linkage | TA03 | |
Position | 32.896 | ||
TF6 | Linkage | TB03 | |
Position | 60.578 | ||
Integrated consensus map | Linkage | A03 | |
Position | 72.149 | ||
Integrated consensus map | Linkage | B03 | |
Position | 47.365 | ||
SNP | Position | ||
Method | |||
SSR | Fragment size | ||
Pattern* | |||
Repeat count | |||
Method | PCR | ||
Detection | |||
Multiplex | |||
Gel image | |||
Enzyme | |||
Related markers | Marker name | ||
Species | |||
Comments | He et al. (2003) ABS0202 |
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.