Arachis hypogaea
Marker Information
| Marker name | PM238 | ||
|---|---|---|---|
| Marker category | Publicly available markers | ||
| Primer sequences | Fw | CTCTCCTCTGCTCTGCACTG | |
| Rv | ACAAGAACATGGGGATGAAGA | ||
| EST/Genome sequences | AY237791 | ||
| Lines | |||
| PIC | Value | ||
| Lines | |||
| Linkage Map | SKF2 | Linkage | LG03.1 |
| Position | 80.830 | ||
| BF6 | Linkage | BB03 | |
| Position | 12.602 | ||
| TF6 | Linkage | TA03 | |
| Position | 32.896 | ||
| TF6 | Linkage | TB03 | |
| Position | 60.578 | ||
| Integrated consensus map | Linkage | A03 | |
| Position | 72.149 | ||
| Integrated consensus map | Linkage | B03 | |
| Position | 47.365 | ||
| SNP | Position | ||
| Method | |||
| SSR | Fragment size | ||
| Pattern* | |||
| Repeat count | |||
| Method | PCR | ||
| Detection | |||
| Multiplex | |||
| Gel image | |||
| Enzyme | |||
| Related markers | Marker name | ||
| Species | |||
| Comments | He et al. (2003) ABS0202 |
||
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.