Arachis hypogaea
Marker Information
Marker name | GM687 | ||
---|---|---|---|
Marker category | Publicly available markers | ||
Primer sequences | Fw | TCCACAATGTGTAGTTCAAGCA | |
Rv | TGGTGACCATTTCAAACTCTTG | ||
EST/Genome sequences | DX516119 | ||
Lines | |||
PIC | Value | ||
Lines | |||
Linkage Map | Integrated consensus map | Linkage | B01 |
Position | 41.370 | ||
SNP | Position | ||
Method | |||
SSR | Fragment size | ||
Pattern* | |||
Repeat count | |||
Method | PCR | ||
Detection | |||
Multiplex | |||
Gel image | |||
Enzyme | |||
Related markers | Marker name | ||
Species | |||
Comments | Nagy et al. (2010) |
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.