Arachis hypogaea
Marker Information
| Marker name | AhTE1018 | ||
|---|---|---|---|
| Marker category | Transposable Element | ||
| Primer sequences | Fw | TGGGATGTGAAGGGAGAAAG | |
| Rv | AAATGAAGATGGCAAAAACATC | ||
| EST/Genome sequences | KITE1138 (Other Page) | ||
| Lines | 10 | ||
| PIC | Value | ||
| Lines | |||
| Linkage Map | NYF2 | Linkage | LG06.2 |
| Position | 146.51 | ||
| TF6 | Linkage | TA06 | |
| Position | 108.39 | ||
| Integrated consensus map | Linkage | A06 | |
| Position | 107.973 | ||
| Integrated consensus map | Linkage | B06 | |
| Position | 152.473 | ||
| SNP | Position | ||
| Method | |||
| SSR | Fragment size | ||
| Pattern* | |||
| Repeat count | |||
| Method | PCR | ||
| Detection | |||
| Multiplex | |||
| Gel image | image6124.jpg,image8131.jpg | ||
| Enzyme | |||
| Related markers | Marker name | ||
| Species | |||
| Comments | Shirasawa et al. (2012) | ||
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.