Arachis hypogaea
Marker Information
Marker name | AhTE0695 | ||
---|---|---|---|
Marker category | Transposable Element | ||
Primer sequences | Fw | AGCATCTTCATTTGAGTAGTTGC | |
Rv | GGGAAATATGATTGGGGAAG | ||
EST/Genome sequences | SATE0019 | ||
Lines | 10 | ||
PIC | Value | ||
Lines | |||
Linkage Map | SKF2 | Linkage | LG06.1 |
Position | 81.277 | ||
Integrated consensus map | Linkage | A10 | |
Position | 32.652 | ||
SNP | Position | ||
Method | |||
SSR | Fragment size | ||
Pattern* | |||
Repeat count | |||
Method | PCR | ||
Detection | |||
Multiplex | |||
Gel image | image6043.jpg,image8029.jpg | ||
Enzyme | |||
Related markers | Marker name | ||
Species | |||
Comments | Shirasawa et al. (2012) |
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.