Arachis hypogaea
Marker Information
Marker name | AhTE0482 | ||
---|---|---|---|
Marker category | Transposable Element | ||
Primer sequences | Fw | GCCAACCGTACAAGAAATCC | |
Rv | GAAATGCAGCCATCAATGAA | ||
EST/Genome sequences | AhTE8i04L15 | ||
Lines | 8 | ||
PIC | Value | ||
Lines | |||
Linkage Map | SKF2 | Linkage | LG06.1 |
Position | 62.381 | ||
BF6 | Linkage | BB10 | |
Position | 33.076 | ||
TF6 | Linkage | TA10 | |
Position | 27.310 | ||
Integrated consensus map | Linkage | A10 | |
Position | 117.042 | ||
Integrated consensus map | Linkage | B10 | |
Position | 74.650 | ||
SNP | Position | ||
Method | |||
SSR | Fragment size | 313 | |
Pattern* | |||
Repeat count | |||
Method | PCR | 58 | |
Detection | |||
Multiplex | |||
Gel image | image4154.jpg,image8096.jpg | ||
Enzyme | |||
Related markers | Marker name | ||
Species | |||
Comments | Shirasawa et al. (2012) |
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.