Arachis hypogaea
Marker Information
| Marker name | AhTE0478 | ||
|---|---|---|---|
| Marker category | Transposable Element | ||
| Primer sequences | Fw | TGAAGCAGCCACACCATACT | |
| Rv | GACGGTTGACTAAAAATGTTGG | ||
| EST/Genome sequences | AhTE8iXS9P03 | ||
| Lines | 8 | ||
| PIC | Value | ||
| Lines | |||
| Linkage Map | SKF2 | Linkage | LG07.1 |
| Position | 83.037 | ||
| NYF2 | Linkage | LG07.1 | |
| Position | 104.610 | ||
| BF6 | Linkage | BB07 | |
| Position | 23.839 | ||
| TF6 | Linkage | TA07 | |
| Position | 27.668 | ||
| Integrated consensus map | Linkage | A07 | |
| Position | 65.011 | ||
| Integrated consensus map | Linkage | B07 | |
| Position | 76.393 | ||
| SNP | Position | ||
| Method | |||
| SSR | Fragment size | 364 | |
| Pattern* | |||
| Repeat count | |||
| Method | PCR | 58 | |
| Detection | |||
| Multiplex | |||
| Gel image | image4137.jpg,image8119.jpg | ||
| Enzyme | |||
| Related markers | Marker name | ||
| Species | |||
| Comments | Shirasawa et al. (2012) | ||
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.