Arachis hypogaea
Marker Information
| Marker name | AhTE0437 | ||
|---|---|---|---|
| Marker category | Transposable Element | ||
| Primer sequences | Fw | TGGCTTTTGGGTGTGTATGA | |
| Rv | GCCACGAGAGAATCCAAAAA | ||
| EST/Genome sequences | AhTE8iHP7G20 | ||
| Lines | 8 | ||
| PIC | Value | ||
| Lines | |||
| Linkage Map | SKF2 | Linkage | LG09.2 |
| Position | 45.769 | ||
| AF5 | Linkage | AA09 | |
| Position | 14.773 | ||
| TF6 | Linkage | TA09 | |
| Position | 34.971 | ||
| Integrated consensus map | Linkage | A09 | |
| Position | 82.510 | ||
| SNP | Position | ||
| Method | |||
| SSR | Fragment size | 408 | |
| Pattern* | |||
| Repeat count | |||
| Method | PCR | 58 | |
| Detection | |||
| Multiplex | |||
| Gel image | image4130.jpg,image8095.jpg | ||
| Enzyme | |||
| Related markers | Marker name | ||
| Species | |||
| Comments | Shirasawa et al. (2012) | ||
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.