Arachis hypogaea
Marker Information
| Marker name | AhTE0392 | ||
|---|---|---|---|
| Marker category | Transposable Element | ||
| Primer sequences | Fw | CCCCACATGGCTTATTTGAG | |
| Rv | TACACGCTGTCAACGTCCAG | ||
| EST/Genome sequences | AhTE8i09J02 | ||
| Lines | 8 | ||
| PIC | Value | ||
| Lines | |||
| Linkage Map | NYF2 | Linkage | LG07.1 |
| Position | 46.791 | ||
| TF6 | Linkage | TA09 | |
| Position | 29.681 | ||
| Integrated consensus map | Linkage | A07 | |
| Position | 120.431 | ||
| Integrated consensus map | Linkage | A09 | |
| Position | 84.206 | ||
| SNP | Position | ||
| Method | |||
| SSR | Fragment size | 542 | |
| Pattern* | |||
| Repeat count | |||
| Method | PCR | 58 | |
| Detection | |||
| Multiplex | |||
| Gel image | image4123.jpg,image8142.jpg | ||
| Enzyme | |||
| Related markers | Marker name | ||
| Species | |||
| Comments | Shirasawa et al. (2012) | ||
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.