Arachis hypogaea
Marker Information
| Marker name | AhTE0343 | ||
|---|---|---|---|
| Marker category | Transposable Element | ||
| Primer sequences | Fw | CGATCGCTACTTGCTACCAC | |
| Rv | GGACATCAATCAAGAGGCGT | ||
| EST/Genome sequences | AhTE8i01M16 | ||
| Lines | 8 | ||
| PIC | Value | ||
| Lines | |||
| Linkage Map | NYF2 | Linkage | LG09.1 |
| Position | 29.454 | ||
| BF6 | Linkage | BB09 | |
| Position | 22.881 | ||
| TF6 | Linkage | TB09 | |
| Position | 32.061 | ||
| Integrated consensus map | Linkage | B09 | |
| Position | 81.433 | ||
| SNP | Position | ||
| Method | |||
| SSR | Fragment size | 418 | |
| Pattern* | |||
| Repeat count | |||
| Method | PCR | 58 | |
| Detection | |||
| Multiplex | |||
| Gel image | image4114.jpg,image8140.jpg | ||
| Enzyme | |||
| Related markers | Marker name | ||
| Species | |||
| Comments | Shirasawa et al. (2012) | ||
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.