Arachis hypogaea
Marker Information
| Marker name | AhTE0254 | ||
|---|---|---|---|
| Marker category | Transposable Element | ||
| Primer sequences | Fw | CTTTCTTTCTATTCGTGCCAAAA | |
| Rv | TTAAAGATCTGTAGCTGGCCAAA | ||
| EST/Genome sequences | AhTE8i_HP1_E21 | ||
| Lines | 8 | ||
| PIC | Value | ||
| Lines | |||
| Linkage Map | SKF2 | Linkage | LG09.1 |
| Position | 12.738 | ||
| BF6 | Linkage | BB09 | |
| Position | 40.409 | ||
| TF6 | Linkage | TB09 | |
| Position | 53.816 | ||
| Integrated consensus map | Linkage | B09 | |
| Position | 103.634 | ||
| SNP | Position | ||
| Method | |||
| SSR | Fragment size | ||
| Pattern* | |||
| Repeat count | |||
| Method | PCR | 58 | |
| Detection | |||
| Multiplex | |||
| Gel image | image4082.jpg,image8086.jpg | ||
| Enzyme | |||
| Related markers | Marker name | ||
| Species | |||
| Comments | Shirasawa et al. (2012) | ||
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.