Arachis hypogaea
Marker Information
Marker name | AhTE0227 | ||
---|---|---|---|
Marker category | Transposable Element | ||
Primer sequences | Fw | CAAACAGTTATCCACGTGCTGT | |
Rv | CAACTCATGCAGCGCTAACTAC | ||
EST/Genome sequences | AhTE8i_SS0_E13 | ||
Lines | 8 | ||
PIC | Value | ||
Lines | |||
Linkage Map | NYF2 | Linkage | LG08.1 |
Position | 95.447 | ||
TF6 | Linkage | TA08 | |
Position | 7.408 | ||
Integrated consensus map | Linkage | A08 | |
Position | 10.914 | ||
SNP | Position | ||
Method | |||
SSR | Fragment size | ||
Pattern* | |||
Repeat count | |||
Method | PCR | 58 | |
Detection | |||
Multiplex | |||
Gel image | image4051.jpg,image4052.jpg,image8138.jpg | ||
Enzyme | |||
Related markers | Marker name | ||
Species | |||
Comments | Shirasawa et al. (2012) |
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.