Arachis hypogaea
Marker Information
Marker name | AhTE0113 | ||
---|---|---|---|
Marker category | Transposable Element | ||
Primer sequences | Fw | TTATGGCATCCAAGGGTCAT | |
Rv | TCCCTAGTACCCGGATGATT | ||
EST/Genome sequences | AhTE8i06P07 | ||
Lines | 8 | ||
PIC | Value | ||
Lines | |||
Linkage Map | SKF2 | Linkage | LG01.2 |
Position | 11.601 | ||
TF6 | Linkage | TB01 | |
Position | 51.012 | ||
Integrated consensus map | Linkage | B01 | |
Position | 62.306 | ||
SNP | Position | ||
Method | |||
SSR | Fragment size | ||
Pattern* | |||
Repeat count | |||
Method | PCR | 58 | |
Detection | |||
Multiplex | |||
Gel image | image4023.jpg,image8077.jpg | ||
Enzyme | |||
Related markers | Marker name | ||
Species | |||
Comments | Shirasawa et al. (2012) |
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.