Arachis hypogaea
Marker Information
| Marker name | AhM005 | ||
|---|---|---|---|
| Marker category | Publicly available markers | ||
| Primer sequences | Fw | CAAATCAATCGCAACCACTT | |
| Rv | TCGGATGAAAAGGCTTACAAA | ||
| EST/Genome sequences | AhM005 | ||
| Lines | |||
| PIC | Value | ||
| Lines | |||
| Linkage Map | SKF2 | Linkage | LG05.2 |
| Position | 25.521 | ||
| Integrated consensus map | Linkage | B05 | |
| Position | 31.001 | ||
| SNP | Position | ||
| Method | |||
| SSR | Fragment size | ||
| Pattern* | |||
| Repeat count | |||
| Method | PCR | ||
| Detection | |||
| Multiplex | |||
| Gel image | |||
| Enzyme | |||
| Related markers | Marker name | ||
| Species | |||
| Comments | Naito et al. (2008) | ||
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.