Arachis hypogaea
Marker Information
| Marker name | AHS2951 | ||
|---|---|---|---|
| Marker category | EST-SSR | ||
| Primer sequences | Fw | GGGCACGTTTGTTGAATCTT | |
| Rv | CTGCTTGCCCTGTTGCAG | ||
| EST/Genome sequences | AHCR12I23 | ||
| Lines | |||
| PIC | Value | ||
| Lines | |||
| Linkage Map | AF5 | Linkage | AA03 |
| Position | 24.562 | ||
| BF6 | Linkage | BB03 | |
| Position | 20.899 | ||
| TF6 | Linkage | TA03 | |
| Position | 49.745 | ||
| Integrated consensus map | Linkage | A03 | |
| Position | 87.841 | ||
| Integrated consensus map | Linkage | B03 | |
| Position | 57.205 | ||
| SNP | Position | ||
| Method | |||
| SSR | Fragment size | 187 | |
| Pattern* | AGC(mis1) | ||
| Repeat count | 5 | ||
| Method | PCR | ||
| Detection | |||
| Multiplex | |||
| Gel image | AHS2951_2975.ppt Download | ||
| Enzyme | |||
| Related markers | Marker name | ||
| Species | |||
| Comments | Koilkonda et al. (2012) | ||
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.