Arachis hypogaea
Marker Information
| Marker name | AHS2430 | ||
|---|---|---|---|
| Marker category | EST-SSR | ||
| Primer sequences | Fw | AATAAGGTGGTGGTCCATGC | |
| Rv | GGGAATCTGCAAAGCCATTA | ||
| EST/Genome sequences | AHCL11L14 | ||
| Lines | |||
| PIC | Value | ||
| Lines | |||
| Linkage Map | BF6 | Linkage | BB03 |
| Position | 32.387 | ||
| TF6 | Linkage | TA03 | |
| Position | 69.327 | ||
| Integrated consensus map | Linkage | A03 | |
| Position | 109.148 | ||
| Integrated consensus map | Linkage | B03 | |
| Position | 68.374 | ||
| SNP | Position | ||
| Method | |||
| SSR | Fragment size | 232 | |
| Pattern* | AAT(mis2) | ||
| Repeat count | 5 | ||
| Method | PCR | ||
| Detection | |||
| Multiplex | |||
| Gel image | AHS2426_2450.ppt Download | ||
| Enzyme | |||
| Related markers | Marker name | ||
| Species | |||
| Comments | Koilkonda et al. (2012) | ||
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.