Arachis hypogaea
Marker Information
| Marker name | AHS2278 | ||
|---|---|---|---|
| Marker category | EST-SSR | ||
| Primer sequences | Fw | AACACGTTGAACCGTTTTCG | |
| Rv | GCACCCACAGCTACAAGTGA | ||
| EST/Genome sequences | AHCL12C22 | ||
| Lines | |||
| PIC | Value | ||
| Lines | |||
| Linkage Map | AF5 | Linkage | AA04 |
| Position | 21.233 | ||
| AF5 | Linkage | AA09 | |
| Position | 13.848 | ||
| TF6 | Linkage | TA09 | |
| Position | 36.545 | ||
| Integrated consensus map | Linkage | A04 | |
| Position | 30.564 | ||
| Integrated consensus map | Linkage | A09 | |
| Position | 80.865 | ||
| SNP | Position | ||
| Method | |||
| SSR | Fragment size | 197 | |
| Pattern* | AAG | ||
| Repeat count | 8 | ||
| Method | PCR | ||
| Detection | |||
| Multiplex | |||
| Gel image | AHS2276_2300.ppt Download | ||
| Enzyme | |||
| Related markers | Marker name | ||
| Species | |||
| Comments | Koilkonda et al. (2012) | ||
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.