Arachis hypogaea
Marker Information
Marker name | AHS2274 | ||
---|---|---|---|
Marker category | EST-SSR | ||
Primer sequences | Fw | AATTCGAGGGTGCTGAAATG | |
Rv | AGCAAGACACAGGCCACTTT | ||
EST/Genome sequences | AHCL19F16 | ||
Lines | |||
PIC | Value | ||
Lines | |||
Linkage Map | SKF2 | Linkage | LG04.1 |
Position | 48.338 | ||
AF5 | Linkage | AA04 | |
Position | 39.636 | ||
TF6 | Linkage | TA04 | |
Position | 56.447 | ||
Integrated consensus map | Linkage | A04 | |
Position | 49.711 | ||
Integrated consensus map | Linkage | B04 | |
Position | 72.911 | ||
SNP | Position | ||
Method | |||
SSR | Fragment size | 292 | |
Pattern* | AAT | ||
Repeat count | 10 | ||
Method | PCR | ||
Detection | |||
Multiplex | |||
Gel image | AHS2251_2275.ppt Download | ||
Enzyme | |||
Related markers | Marker name | ||
Species | |||
Comments | Koilkonda et al. (2012) |
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.