Arachis hypogaea
Marker Information
| Marker name | AHS2228 | ||
|---|---|---|---|
| Marker category | EST-SSR | ||
| Primer sequences | Fw | CCACCATTTTGGTGCTCTCT | |
| Rv | AGGTGGAGTTGGAGTTGGTG | ||
| EST/Genome sequences | AHCL07D21 | ||
| Lines | |||
| PIC | Value | ||
| Lines | |||
| Linkage Map | AF5 | Linkage | AA03 |
| Position | 0.487 | ||
| AF5 | Linkage | AA03 | |
| Position | 4.573 | ||
| AF5 | Linkage | AA04 | |
| Position | 35.673 | ||
| AF5 | Linkage | AA08 | |
| Position | 25.693 | ||
| Integrated consensus map | Linkage | A03 | |
| Position | 62.979 | ||
| Integrated consensus map | Linkage | A03 | |
| Position | 66.512 | ||
| Integrated consensus map | Linkage | A04 | |
| Position | 53.968 | ||
| Integrated consensus map | Linkage | A08 | |
| Position | 43.221 | ||
| SNP | Position | ||
| Method | |||
| SSR | Fragment size | 200 | |
| Pattern* | GGT(mis2) | ||
| Repeat count | 5 | ||
| Method | PCR | ||
| Detection | |||
| Multiplex | |||
| Gel image | AHS2226_2250.ppt Download | ||
| Enzyme | |||
| Related markers | Marker name | ||
| Species | |||
| Comments | Koilkonda et al. (2012) | ||
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.