Arachis hypogaea
Marker Information
| Marker name | AHS1960 | ||
|---|---|---|---|
| Marker category | EST-SSR | ||
| Primer sequences | Fw | GGAGAGCTTCACTGCTTTGG | |
| Rv | CTTCTTGGCCTCCACATGAT | ||
| EST/Genome sequences | AHCL03P23 (Other Page) | ||
| Lines | |||
| PIC | Value | ||
| Lines | |||
| Linkage Map | TF6 | Linkage | TA05 |
| Position | 25.54 | ||
| TF6 | Linkage | TA09 | |
| Position | 39.198 | ||
| Integrated consensus map | Linkage | A05 | |
| Position | 48.216 | ||
| Integrated consensus map | Linkage | A09 | |
| Position | 74.625 | ||
| SNP | Position | ||
| Method | |||
| SSR | Fragment size | 107 | |
| Pattern* | AAT | ||
| Repeat count | 9 | ||
| Method | PCR | ||
| Detection | |||
| Multiplex | |||
| Gel image | AHS1951_1975.ppt Download | ||
| Enzyme | |||
| Related markers | Marker name | ||
| Species | |||
| Comments | Koilkonda et al. (2012) | ||
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.