Arachis hypogaea
Marker Information
| Marker name | AHS1950 | ||
|---|---|---|---|
| Marker category | EST-SSR | ||
| Primer sequences | Fw | CGGCATTCACCCACTTTC | |
| Rv | TTGAGGTCAGTGTGCCAGAG | ||
| EST/Genome sequences | AHCL01L20 | ||
| Lines | |||
| PIC | Value | ||
| Lines | |||
| Linkage Map | AF5 | Linkage | AA09 |
| Position | 2.765 | ||
| TF6 | Linkage | TB09 | |
| Position | 60.701 | ||
| Integrated consensus map | Linkage | A09 | |
| Position | 68.973 | ||
| Integrated consensus map | Linkage | B09 | |
| Position | 97.318 | ||
| SNP | Position | ||
| Method | |||
| SSR | Fragment size | 242 | |
| Pattern* | AG | ||
| Repeat count | 19 | ||
| Method | PCR | ||
| Detection | |||
| Multiplex | |||
| Gel image | AHS1926_1950.ppt Download | ||
| Enzyme | |||
| Related markers | Marker name | ||
| Species | |||
| Comments | Koilkonda et al. (2012) | ||
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.